دانلود پایان نامه

دانلود پایان نامه

عنوان پایان نامه : پایان نامه استفاده ازماده ترت بوتيل هيدروپراکسايد  t-BHPیک مدل حیوانی از استرس اکسیداتیو به منظور مطالعه اثر آن در چگونگی بیان ژن Kdm5d(Smcy

 

3-7-3-  محلول­ها و بافر­های مورد نیاز جهت روش TUNEL، به ­منظور ارزیابی شکست DNA اسپرم

1- بافر شستشو: PBS

شود. کیت از 10 ویال که 5 عدد آن حاوی محلول نشانگر با درپوش بنفش رنگ و 5 عدد باقیمانده حاوی آنزیم TDT[1] با درپوش آبی می­باشد، تشکیل شده است. محلول آنزیمی، وظیفه شناسایی شکستگی­های موجود در دو رشته DNA، از طریق انتهای آزاد 3´OH را بر عهده دارد. محلول نشانگر، یک نشانگر فلورسنت پلیمرهای نوکلئوتیدی است که به وسیله میکروسکوپ فلورسنت تشخیص داده می­شود.

3-8-  بررسی بیان ژن Kdm5d یا Smcy

ابتدا با روش RT-PCR و سپس با روش Real-Time PCR بيان ژن مورد مطالعه، ارزيابي شد. نام ژن مورد نظر و توالی پرايمر مورد استفاده در جدول3-3 آمده است که با استفاده از نرم افزار Perl Primer طراحی شد و برای اطمینان از پرایمر مربوطه توسط نرم افزار Gene Runner هم چک شد.

 

جدول (3-3): ژن مورد نظر و توالی پرايمر مورد استفاده(که توسط نگارنده طراحی شده است)

نام ژن مورد نظر (5′         3′) توالی پرایمر
Gapdh FOR: 5´GACTTCAACAGCAACTCCCAC 3´

REV: 5´TCCACCACCCTGTTGCTGTA 3´

Kdm5d FOR: 5´ACT TGT CAC TCT GAT GAA TCC T 3´

REV: 5´TCC AAC AGG TAG CCA ATC G 3´

 

 

 

 

 

 

 

3-8-1- استخراج RNA به روش ترایزول

استخراج RNA در سه مرحله، زیر هود شیمیایی و روی یخ انجام شد. برای جلوگیری از آلودگی با DNA و احتمال از دست رفتن RNA، از ویال­های DNase-RNase free و سرسمپلرهای فیلتردار استفاده گردید.

مراحل کار به شرح ذيل مي‌باشد:

[1]Terminal deoxynucleotidyl transferase

 
 
 

 دانلود  رایگان فایل دموی این پایان نامه

 ( فقط حاوی صفحات فرد و حداکثر فقط 50 صفحه  با فرمت ورد ) :

پایان نامه استفاده ازماده ترت بوتيل هيدروپراکسايد t-BHPیک مدل حیوانی از استرس اکسیداتیو به منظور مطالعه اثر آن در چگونگی بیان ژن Kdm5d(Smcy

دانلود  رایگان فایل دموی این پایان نامه

 ( فقط حاوی صفحات فرد و حداکثر فقط 50 صفحه  با    فرمتPDF ) :

پایان نامه استفاده ازماده ترت بوتيل هيدروپراکسايد t-BHPیک مدل حیوانی از استرس اکسیداتیو به منظور مطالعه اثر آن در چگونگی بیان ژن Kdm5d(Smcy

 برای دیدن جزئیات بیشتر ، خرید و دانلود آنی فایل متن کامل با فرمت ورد می توانید به لینک زیر مراجعه نمایید:

دانلود از لینک زیر

پایان نامه کارشناسی ارشد استفاده ازماده ترت بوتیل هیدروپراکساید t-BHPیک مدل حیوانی از استرس اکسیداتیو به منظور مطالعه اثر آن در چگونگی بیان ژن (Kdm5d(Smcy