دانلود پایان نامه

دانلود پایان نامه

عنوان پایان نامه : پایان نامه استفاده ازماده ترت بوتيل هيدروپراکسايد  t-BHPیک مدل حیوانی از استرس اکسیداتیو به منظور مطالعه اثر آن در چگونگی بیان ژن Kdm5d(Smcy

 

3-7-3-  محلول­ها و بافر­های مورد نیاز جهت روش TUNEL، به ­منظور ارزیابی شکست DNA اسپرم

1- بافر شستشو: PBS

شود. کیت از 10 ویال که 5 عدد آن حاوی محلول نشانگر با درپوش بنفش رنگ و 5 عدد باقیمانده حاوی آنزیم TDT[1] با درپوش آبی می­باشد، تشکیل شده است. محلول آنزیمی، وظیفه شناسایی شکستگی­های موجود در دو رشته DNA، از طریق انتهای آزاد 3´OH را بر عهده دارد. محلول نشانگر، یک نشانگر فلورسنت پلیمرهای نوکلئوتیدی است که به وسیله میکروسکوپ فلورسنت تشخیص داده می­شود.

3-8-  بررسی بیان ژن Kdm5d یا Smcy

ابتدا با روش RT-PCR و سپس با روش Real-Time PCR بيان ژن مورد مطالعه، ارزيابي شد. نام ژن مورد نظر و توالی پرايمر مورد استفاده در جدول3-3 آمده است که با استفاده از نرم افزار Perl Primer طراحی شد و برای اطمینان از پرایمر مربوطه توسط نرم افزار Gene Runner هم چک شد.

 

جدول (3-3): ژن مورد نظر و توالی پرايمر مورد استفاده(که توسط نگارنده طراحی شده است)

نام ژن مورد نظر (5′         3′) توالی پرایمر
Gapdh FOR: 5´GACTTCAACAGCAACTCCCAC 3´

REV: 5´TCCACCACCCTGTTGCTGTA 3´

Kdm5d FOR: 5´ACT TGT CAC TCT GAT GAA TCC T 3´

REV: 5´TCC AAC AGG TAG CCA ATC G 3´

 

 

 

 

 

 

 

3-8-1- استخراج RNA به روش ترایزول

استخراج RNA در سه مرحله، زیر هود شیمیایی و روی یخ انجام شد. برای جلوگیری از آلودگی با DNA و احتمال از دست رفتن RNA، از ویال­های DNase-RNase free و سرسمپلرهای فیلتردار استفاده گردید.

مراحل کار به شرح ذيل مي‌باشد:

[1]Terminal deoxynucleotidyl transferase

 
 
 

 دانلود  رایگان فایل دموی این پایان نامه

 ( فقط حاوی صفحات فرد و حداکثر فقط 50 صفحه  با فرمت ورد ) :

پایان نامه استفاده ازماده ترت بوتيل هيدروپراکسايد t-BHPیک مدل حیوانی از استرس اکسیداتیو به منظور مطالعه اثر آن در چگونگی بیان ژن Kdm5d(Smcy

دانلود  رایگان فایل دموی این پایان نامه

 ( فقط حاوی صفحات فرد و حداکثر فقط 50 صفحه  با    فرمتPDF ) :

پایان نامه استفاده ازماده ترت بوتيل هيدروپراکسايد t-BHPیک مدل حیوانی از استرس اکسیداتیو به منظور مطالعه اثر آن در چگونگی بیان ژن Kdm5d(Smcy

 برای دیدن جزئیات بیشتر ، خرید و دانلود آنی فایل متن کامل با فرمت ورد می توانید به لینک زیر مراجعه نمایید:

دانلود از لینک زیر

پایان نامه کارشناسی ارشد استفاده ازماده ترت بوتیل هیدروپراکساید t-BHPیک مدل حیوانی از استرس اکسیداتیو به منظور مطالعه اثر آن در چگونگی بیان ژن (Kdm5d(Smcy

Related Posts

دسته اصلی

اجاره خوردرو-ماشین عروس-اجاره اتوبوس دربستی-اجاره ون- تاکسی فرودگاه

اجاره بنز s500 اجاره بنز اس 500 اجاره خودرو تشریفاتی ,اجاره خودرو شیک , مدل بالا , vip ,اجاره روزانه با راننده ,اجاره روزانه بدون راننده ,ماشین عروس با راننده ,ماشین عروس بدون راننده ویژه Read more…

دسته اصلی

چارتر لحظه آخری

بلیط لحظه آخری به شرایطی می گن که آژانسای مسافرتی زمان قانونی توان پرکردن ظرفیت هواپیما رو نداشته و به دنبال جبران اون با به کار گیری بلیطای ارزون تر هستن. این بلیطا واسه کسائی Read more…

دسته اصلی

پیچ و رولپلاک با طناب

آیا می دانید تا به امروز استفاده از پیچ و رولپلاک با طناب برای محکم کردن سنگ نما از بهترین روش های محکم سازی به شمار می آید؟ تعجب نکنید! استفاده از پیچ و رولپلاک Read more…